DNA translation

Deoxyribonucleic acid (DNA) consists of a sequence of base pairs of nucleotides to form a double helix structure difficult. Through a series of complex biochemical processes of the nucleotide sequences of DNA of an organism are translated into proteins, it takes a lifetime. The objective of this problem is to write a computer program that accepts a DNA strand and the reports of the protein generated, if any, of the DNA strand.

On the bases of nucleotides of DNA is built are adenine, cytosine, guanine and thymine (hereafter referred to as A, B, D and T, respectively). These bonuses bases on one chain to form half of the DNA strand. The other half of the DNA strand is a similar chain, but each nucleotide is replaced by its complementary base. A and T bases are complementary as foundations are C and D. `` These two polovin''napravleniya DNA are associated with the connection of additional bases to form DNA strands.

Single DNA strand is a list of just writing the bases, which form the main chapter (complementary strand can always be supplemented by a written set of bases in the main thread). For example, a chapter TACTCGTAATTCACT DNA sequence which would complement ATGAGCATTAAGTGA. Note that is always associated with T and C is always associated with G.

Since the main direction of DNA, one strand of ribonucleic acid (RNA), known as messenger RNA (mRNA for short) is produced in a process known as transcription. The transcribed mRNA is identical to the additional DNA strand except that thymine is replaced with a nucleotide called uracil (hereafter U). For example, the DNA chain mRNA in the preceding paragraph shall AUGAGCAUUAAGUGA.

This is a series of bases in the mRNA, that determines the protein to be synthesized. Bases in the mRNA can be seen as a set of codons, each codon having exactly three bases. August marks the start codon of the protein sequence, and each of the codons UAA, UAG or UGA marks the end of the series. In one or more codons between the start and termination codons of a sequence of amino acids that are synthesized to form a protein. For example, the mRNA codon AGC corresponds to the amino acid serine (Ser), AUU corresponds to isoleucine (Ile), and AAG corresponds to lysine (Lys). Thus, proteins derived from mRNA in the example above, in abbreviated form, Ser-Ile-Liss.

The complete genetic code of the codons are translated into amino acids shown in the table below (note that abbreviations are only amino acids). It should be noted that once August and has been established that the sequence may correspond to the beginning of the amino acid methionine (MET). So, first of August in the mRNA sequence chapter is the beginning, but after August codons tend to be converted into amino acids Met.
Input and output
Entrance into this program contains the DNA sequence elements, a chain line the protein that generates, if necessary, should be determined and output. Since DNA strand can be either primary or complementary DNA strand, and may appear in any order or reverse, and at the beginning and end sequences do not always appear at the end of the chain. For example, a particular input DNA to form a protein Ser-Ile-Lys can be any of ATACTCGTAATTCACTCC, CCTCACTTAATGCTCATA, TATGAGCATTAAGTGAGG or GGAGTGAATTACGAGTAT. The input file will be terminated by a line containing an asterisk.

You can get input to contain only valid on the case, a nucleotide base letters (A, C, D and T).Online contributions will not exceed 255 characters. There will be no blank lines or spaces at the entrance.
Some sequences, though valid DNA strands do not produce valid protein sequences; chain DNA transfer ``*** not ***'' found out, when a string of input DNA is not translated into protein effect. In addition, some sequences may be translated into several different proteins. In this case, an impression of them.

Sample Input
ATACTCGTAATTCACTCC
CACCTGTACACAGAGGTAACTTAG
TTAATACGACATAATTAT
GCCTTGATATGGAGAACTCATTAGATA
AAGTGTATGTTGAATTATATAAAACGGGCATGA
ATGATGATGGCTTGA
*
Sample output
Ser-Ile-Lys
CYS-Leu-His
Ser-Tyr
*** No transfer of DNA found ***
Liu-ASN-Tyr-Ile-Lys-Arg-Ala
Met-Ala-met